Aktuelles

URSPRUNG/ORIGINS - eine Versuchsannäherung
über die Selbstorganisation der Materie und Entstehung des ersten Lebens auf der Erde

Eine Ausstellung zur Projektrealisierung der ersten Preisträgerin Judith Egger des interdisziplinären Münchner Kunstpreises „zwei:eins“ im Dialog mit Prof. Dieter Braun
Dauer der Ausstellung vom 24. April - 14. Mai 2017
Öffnungszeiten: Mi – So 10.00 - 18.00 Uhr
Ort: whiteBOX, Atelierstraße 18, München
www.whitebox-muenchen.de
Präsentation der Ausstellung und einer Publikation am 11. Mai um 19 Uhr

Hier können Sie den Begleittext als PDF downloaden.

In seinem Labor in der Ludwig-Maximilians-Universität in München ist der Biophysiker Dieter Braun auf der Suche nach neuen Erkenntnissen über die Entstehung des Lebens vor mehr als vier Milliarden Jahren. Der Weg von Einzellern zu immer komplexeren Lebewesen ist uns zwar bekannt, doch welche Prozesse haben die Evolution der ersten Moleküle vorangetrieben? Diesen „springenden Punkt“ will Dieter Braun erforschen. Dabei geht er davon aus, dass erste Erbmoleküle bereits im von Meerwasser umspülten, noch heißem Vulkangestein entstanden sind.

Das Prinzip, das der Entstehung des Lebens zugrunde liegt, fasziniert seit vielen Jahren auch die Künstlerin Judith Egger. So wie Dieter Braun und doch ganz anders treibt sie die Frage nach der „Lebenskraft“ um. Der „Élan vital“ beschäftigt sie in Installationen, Zeichnungen und Performances.
Den Urknall kann man nicht simulieren. Die klimatischen und chemischen Bedingungen direkt nach der Entstehung unseres Planeten kann man ebenfalls nicht rekonstruieren. Hier kommt das Hypothetische ins Spiel das die beiden, Dieter Braun in seiner Forschung und Judith Egger in ihrer künstlerische Arbeit, berühren. Sie verbindet der Prozess des Experimentierens und der Erkenntnissuche: Der Weg ist das Ziel! Das ist der Auftakt für einen spannenden Austausch zwischen zwei unterschiedlichen Methoden, die Welt zu erkennen. Über einen Zeitraum von mehr als eineinhalb Jahren entwickelt sich eine „Feedbackspirale“: ein Dialog, bei dem Fotos, Filme, Interviews, Installationen, Zeichnungen und Objekte zum Einsatz kommen und als Kommunikationsmittel genutzt werden.

Im Gegensatz zu Dieter Brauns Herangehensweise ist Judith Eggers künstlerische Auseinandersetzung subjektiv – getragen von Vorlieben, Intuition, Zufällen und inneren Bildern, die in Reaktion auf Gelesenes oder Gesagtes auftauchen und ihre künstlerische Form im verwendeten Material finden. Die Ergebnisse dieses Prozesses sind in dieser Ausstellung sowie anhand eines Buches (Präsentation am 11. Mai) nachvollziehbar.

Judith Egger

Die Künstlerin lebt und arbeitet in München. Sie studierte am Royal College of Arts, London, und erhielt 2001 dort ihren Master Degree. Sie hatte zahlreiche Einzel- und Gruppenausstellungen im In- und Ausland. Bereits 2004 gründete sie ihr künstlerisches „Institut für Hybristik und empirische Schwellkörperforschung“. Die Einrichtung ist für Judith Egger eine Art Forschungslabor, in welchem sie das Thema für ihre Arbeit findet: die künstlerische Gestaltung und Abbildung der Lebenskraft mit dem Schwerpunkt Natur mittels Zeichnung, Objektkunst und Performance. Judith Egger nähert sich ihrem Thema mit großer Konzentration und wertfreiem Blick. Dessen ungeachtet wird der Betrachter über eine sehr sinnliche Ebene von den Werken Eggers angezogen. Die Materialien, die die Künstlerin verwendet, stammen oft aus den Bereichen des Organischen und Pflanzlichen. Auf diese Weise entstehen anarchische Prozesse des Wachsens, Wucherns und Fließens. www.judithegger.com

Dieter Braun

Prof. Dieter Braun ist System-Biophysiker. Er studierte Physik an der Universität Ulm und der TU München mit dem Diplomabschluss 1997. Er wurde 2000 am Max-Planck-Institut für Biophysik summa cum laude promoviert, war als Post-Doktorand 2000 bis 2003 an der Rockefeller University und habilitierte sich 2007 in Physik in München. Er ist Professor für Biophysik an der Ludwig-Maximilians- Universität München. 2010 erhielt er den Starting Grant des European Research Council. 2011 bekam Braun den Klung-Wilhelmy-Weberbank-Preis „für seine Erkenntnisse über die Entstehung des Lebens auf der Erde vor mehr als drei Milliarden Jahren.“ 2016 gründete Dieter Braun das Netzwerk OLIM (Origins of Life Initiative Munich), an dem eine Reihe von Münchner Wissenschaftlerinnen und Wissenschaftler aus unterschiedlichen Disziplinen beteiligt sind. www.biosystems.physik.lmu.de

Großer Raum, Beschreibung der Arbeiten

DNA-Replikation, 2016/17

Material: Reissverschlüsse

Die DNA ist der Träger der Erbinformation und befindet sich im Zellkern. Wenn sich eine Zelle teilen will, hat sie sich vorher vergrößert und auch die DNA verdoppelt. Die Verdopplung von DNA Strängen - und somit dem Erbgut - funktioniert extrem vereinfacht dargestellt in einer Art Reissverschlussprinzip.


Gedenkstein, 2017

Material: Plastilin, Taschenlampe

Nach Schätzungen von Wissenschaftlern sind bisher etwa 500 Millionen Tierarten ausgestorben. Das sind über 99 Prozent aller Tierarten. Auf dem Gedenkstein steht „In Gedenken an die 500 Millionen ausgestorbenen Tierarten“ und bezieht sich auf den Prozess der Evolution, der jeder Weiterentwicklung zugrunde liegt.


Tresor/Black Box, 2017

Material: Metalltresor, graviertes Messing

Die in die Messingscheibe eingravierte Sequenz ist eine wissenschaftliche Darstellung des „Baum des Lebens“. Sie stellt die Evolution der Arten dar, wobei sich aus den ersten einfachen Organismen immer komplexere Lebensformen bilden. Je weiter man auf der Scheibe nach Innen wandert, desto näher kommt man dem „Ursprung des Lebens“ - an dem auch Dieter Braun forscht. Seiner eigenen Aussage nach werden die Menschen diesen „Code“ nie knacken. Somit bleibt diese Black Box für immer gschlossen. Mehr Information hierüber kann man im Transkript des Gesprächs zwischen Judith Egger und Dieter Braun nachlesen (liegt im Labor/Atelierraum auf dem Tisch links).


Staub, 2017

video

Die Elemente, aus denen sich unser Körper zu 97 Prozent zusammensetzt, sind in der Mitte unserer Milchstraße reichlich vorhanden. Sie entstanden in ferner Vergangenheit im Inneren von Sternen und haben uns nach einer langen Reise erreicht, um das aus uns zu machen, was wir heute sind – Menschen. Das ergab eine Analyse von 150.000 Sternen (laut einer Studie um Sten Hasselquist von der New Mexico State University).


LUCA (Last Universal Common Ancestor), 2017

video

Unser Urvorfahr- der letzte allgemeine gemeinsame Vorfahre („Last Universal Common Ancestor“) ist der - hypothetische - letzte gemeinsame Vorfahre aller heute lebendender Lebewesen auf der Erde. Es wird davon ausgegangen, dass diese Urform allen heutigen Lebens vor mindestens 3,5 Milliarden Jahren, also im späten Hadaikum oder frühen Archaikum, gelebt hat. (1) Er war kein diffuser Zellschleim, sondern schon ein äusserst komplexer Einzeller. Ein Fragment davon steckt heute in jeder Zelle unseres Körpers, in Katzen, Hunden, Fischen, Bienen..in all den Pflanzen und den Batterien unseres Darms, in jedweder Lebensform. Es ist eine Sequenz, die jenen Teil eines RNA_Enzyms kodiert, der eine Schlüsselrolle bei der Synthese von Proteinen spielt: GTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGCTGCAGTTAAAAAG Im Video „LUCA“ wird diese Sequenz auf dem Prägegerät ausgedruckt. (1) Quelle. 1.https://de.wikipedia.org/wiki/Urvorfahr, (2) Raoul Schrott, Erste Erde Epos, S 748-749


Linsen, 2017

Rauminstallation aus Erde und ungeschliffenen und geschliffenen Linsen

Dieter Braun sagte: „Die eigentliche Frage nach dem Ursprung des Lebens gibt es erst seit 1889/90, erst mit der Hilfe der Mikroskopie, denn damit konnte man erst feststellen dass Leben auf EIN Ding zurückzuführen ist und sich nicht andauernd neu entwickelt.“ Linsen sind ein wesentliches Bestandteil eines Mikroskops. Anhand geschliffener Linsen ist es möglich, ganz andere Dimensionen der Wahrnehmung unserer Wirklichkeit vorzudringen. Viele unterschiedliche Blickwinkel formen unser Wissen über die Welt, je nach Stand der wissenschaftlichen Erkenntnisse und Weltanschauung ist unser „Wissensgebäude“ in stetem Wandel.

Labor/Atelierraum

Vulkanquellen, 2017

Material: Ton, Herdplatte, Wasser, Topf

Dieter Braun geht davon aus, dass erste Erbmoleküle im von Meerwasser umspülten, noch heißem Vulkangestein entstanden sind. Wichtig für diesen Prozess ist das thermodynamische Ungleichgewicht. Vulkane, deren Lava sich ins Meer ergießt, bieten geradezu ideale Voraussetzungen für diesen Prozess - ebenso die hydrothermalen Schlote der Tiefsee, die so genannten „Schwarzen Raucher.“ Diese speien unaufhörlich kochend heißes Wasser, Vulkangase und Metallsulfide ins Meer. Entlang der Strömungskanäle kommt das Wasser mit den Poren umliegenden Gesteins im Berührung und erzeugt jenes Temperaturgefälle, das es zum Festhalten und Aufkonzentrieren der eindringenden Moleküle braucht - eine Voraussetzung für die Entstehung und Vervielfältigung komplexer Biomoleküle. Dieter Braun und sein Team bauen diese Umgebung in ihrem Labor nach.


DNA Gras, 2017

Gras, Fototapete

Inspiriert von wissenschaftlichen Darstellungen von DNA-Strängen, die in den ersten zellulären Lebewesen (genannt Prokaryoten) frei herumschwimmen habe ich aus Gras ähnliche aussehende Strukturen nachgebildet, aufgehängt und fotografiert. Das dabei entstandene menschliche Gesicht war purer Zufall und fügt dieser Arbeit neue Ebenen hinzu.


Urknallbrille, 2016

Brille, Acrylfarbe

Diese Brille spielt darauf an, dass es nicht möglich ist zum Urknall zurückzukehren und somit auch nicht den genauen Hergang der Entsehung des Lebens und der Erde wissenschaftlich eindeutig zu beweisen. Wenn man sich die Brille aufsetzt, wird man automatisch zum Moment des Urknalls katapultiert!


Silicium, 2016

Siliciumscheibe aus Dieter Brauns Labor, Kugelschreiber, Papier

Silicium II

fotografisches Selbstportrait als Spieglung in Siliciumscheibe aus Dieter Brauns Labor, Kugelschreiber, Papier, Tapete

Die aus dem Labor entwendete Siliciumplatte dient als kühlende Basis für die Molekülfalle. Sie ist ein Kernstück für Dieter Brauns Experiemente zur Entwicklung des ersten Lebens auf der Erde. Die Siliciumscheibe war Ausgangspunkt für ein zeichnerisches und fotografisches Selbstportrait, in dem meine Auseinandersetzung mit den komplexen Inhalten des Themas „Ursprung des Lebens“ sichtbar wird.


Wissensgebäude, 2016

Speckstein, Mikroskopierplättchen Draht

Auszug aus dem Gespräch:
Judith: Ich habe zu dem Gedanken, dass das Wissen immer auf dem der vorigen Generationen aufbaut eine Arbeit gemacht, die sich „Wissensgebäude“ nennt - die Glasplättchen sind dabei Blickwinkel oder Gewissheiten, die ineinander greifen, aufeinander aufbauen und immer auch durch ihren Winkel und ihre Grösse beschränkt bleiben. Der Stein ist die Welt, auf die geblickt wird. Das Wissen ist fragil, viele Gesetzmässigkeiten sind schon seit mehreren hundert Jahren bewiesen..aber die Realität ist ..
Dieter: …immer noch viel komplexer! Bewiesen ist nie etwas für immer - es muss nur jemand ein neues Experiment machen, das zum Beispiel Einstein widerspricht und auf einmal ist alles anders. Die Gesetzmässigkeiten scheinen immer so gefestigt, sind es aber nicht immer.


Video und Transkript der Gespräche, 2015-2017

Künstlerisches Video und Auszug aus dem Gespräch von Dieter Braun und Judith Egger. Transkript der Gespräche.
Die Gespräche werden auch in der am 11. Mai in der whiteBOX präsentierten Publikation zu lesen sein.

zwei:eins - Netzwerk

  • zwei:eins wird von einem Netzwerk getragen, vergeben und begleitet.

  • SoNet – Soziales Netzwerk München e.V.
    als Stifter von zwei:eins

 

 

Partner bis 2015